Q.If the coding sequence in a transcription unit is written as follows : 5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the nucleotide sequence of mRNA.

A hairpin loop forms in the nascent RNA at the termination stage of transcription (Rho-independent termination).

In prokaryotic transcription termination (the Rho-independent/intrinsic mechanism), the DNA template near the end of a gene has an inverted-repeat, GC-rich sequence followed by a stretch of A residues. As RNA polymerase transcribes this region, the newly made RNA (which is complementary, GC-rich and self-complementary) folds back on itself to form a stable hairpin (stem-loop) structure, immediately followed by a run of U residues. This hairpin causes RNA polymerase to pause and destabilises the RN …

Rho protein mediates Rho-dependent termination, ending transcription.

Transcription termination in bacteria can be Rho-dependent or Rho-independent (intrinsic). In Rho-dependent termination:

• The Rho (p) protein, an ATP-dependent helicase, binds to a specific sequence (rut site) on the newly synthesised mRNA.
• It translocates along the RNA (using energy from ATP hydrolysis) and catches up with RNA polymerase paused at a terminator sequence. …

mRNA is produced by transcription -- copying genetic information from a DNA template strand into a complementary RNA strand.

In the central dogma of molecular biology, transcription is the process by which RNA polymerase reads a DNA template strand (3'->5') and synthesises a complementary, antiparallel mRNA strand (5'->3'), carrying the same sequence as the coding/sense strand of DNA (with U instead of T). Translation is a distinct, later process, in which ribosomes read the mRNA codons to assemble a polypeptide. Replication is …

The central dogma states that genetic information normally flows from DNA to RNA to protein.

Working

Proposed by Francis Crick, the central dogma of molecular biology describes the standard directional flow of genetic information within a cell:

1. DNA -> RNA (Transcription): the genetic information encoded in a gene's DNA sequence is copied into a complementary messenger RNA (mRNA) molecule by the enzyme RNA polymerase.
2. RNA -> Protein (Translation): the mRNA sequence is read by ribosomes (with the help of tRNA) in sets of three nucleotides (codons), and each codon specifies a particular amino acid, which are joined together to build a polypeptide/protein. …

mRNA constitutes about 5-10% of a cell's total RNA content.

A cell contains three principal classes of RNA involved in protein synthesis, present in very different proportions. Ribosomal RNA (rRNA) is by far the most abundant, forming roughly 80% of total cellular RNA because it is a structural and catalytic component of the numerous ribosomes in the cell. Transfer RNA (tRNA) makes up most of the remainder, around 10-15%, since many small tRNA molecules are needed to deliver amino acids during translation. Messenger RNA (mRNA), despite being the direct carrier of genetic information from DNA to the ribosome, is present in the smallest amount, only about 5-10% …