Q.Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow : mRNA 5' – UCAUUACCACGAUUCUUUAAAGA – 3'
🔒You're viewing a preview — the full solution, concept, methods & PYQ mapping are locked.
🔒 Start your 14-day free trial to unlock the full solution →Concept understanding — Point Mutation
Let’s begin with something you already know: a typo.
Imagine you are typing a long paragraph on your phone. You mean to type “I will meet you at the gate,” but your thumb slips and you type “I will meet you at the gate.” One letter changed — the whole meaning stays the same. But if you had typed “I will meet you at the hate,” that single letter change flips the meaning entirely.
Now scale that idea down to the microscopic level of your own body. Every cell in you contains a long, coiled instruction manual written in a chemical language — DNA. That manual is made of four letters (A, T, G, C) arranged in precise sequences. A point mutation is exactly what it sounds like: a change in just one of those letters.
What a point mutation is, precisely
A point mutation is a change in a single nucleotide base pair in the DNA sequence. In NCERT terms, it is “a change in a single base pair of DNA.” That is the textbook definition.
There are three common types you should know:
- Substitution – one base is swapped for another (like changing A to G).
- Insertion – an extra base is added in the middle of the sequence.
- Deletion – one base is removed.
Insertions and deletions are especially important because they can shift the entire reading frame of the genetic code — a phenomenon called frameshift mutation. Substitutions may or may not change the resulting protein, depending on whether they fall in a critical spot.
The word “point” refers to the location — a single, specific point on the DNA molecule. It does not mean the mutation is small in effect. A single-letter change can be harmless, or it can cause a disease like sickle‑cell anaemia (where one base change alters the shape of haemoglobin).
Why it matters
Point mutations are the raw material of evolution. Without them, all life would be a perfect copy of its ancestors — no variation, no adaptation. Most point mutations are neutral or harmful, but a rare few give an organism an advantage, and over generations those can spread through a population.
In medicine, point mutations are the cause of many genetic disorders. In agriculture, breeders look for beneficial point mutations that give crops resistance to pests or drought. In your own body, point mutations that accumulate in cells over a lifetime can lead to cancer. …
Let’s take this step by step, exactly as the NCERT logic works.
First, we need to break the given mRNA into codons (triplets). The sequence is:
5' – UCA UUA CCA CGA UUC UUU AAA GA – 3'
Counting from the start, the codons are:
- UCA
- UUA
- CCA
- CGA
- UUC
- UUU
- AAA
- GA (incomplete — only two bases, so not a full codon)
So the original mRNA codes for 7 full codons, meaning 7 amino acids in the polypeptide chain (assuming no stop codon appears).
(a) Substitution of 'U' by 'C' at the 5th codon
The 5th codon originally is UUC (codes for Phenylalanine).
If the first base 'U' is replaced by 'C', the codon becomes CUC.
According to the genetic code, CUC codes for Leucine.
This is a missense mutation — one amino acid changes, but the rest of the chain remains unaffected.
So the number of amino acids formed remains 7, because no stop codon is introduced.
A single base substitution does not change the number of amino acids unless it creates a stop codon. Here, CUC is not a stop codon.
(b) Fourth codon: 'C' replaced by 'U'
The 4th codon originally is CGA (codes for Arginine).
If the middle base 'C' is replaced by 'U', the codon becomes UGA.
UGA is one of the three stop codons (UAA, UAG, UGA). …
A single base substitution in an mRNA codon can either change one amino acid or introduce a premature stop codon, drastically shortening the polypeptide — the effect depends entirely on which codon is altered and what the new codon codes for.
Let’s first read the given mRNA sequence carefully. It is written as:
5' – UCA UUA CCA CGA UUC UUU AAA GA – 3'
The ribosome reads this in triplets (codons) from the 5' end. So the codons are:
- UCA
- UUA
- CCA
- CGA
- UUC
- UUU
- AAA
- GA (incomplete — only two bases, so it does not code for an amino acid)
Thus, the original mRNA codes for seven amino acids (codons 1 through 7), with the eighth triplet being incomplete and therefore not translated.
Now, part (a) asks: what happens if the 5th codon (UUC) has its first base 'U' substituted by 'C'? That changes UUC to CUC. According to the standard genetic code, UUC codes for phenylalanine (Phe), while CUC codes for leucine (Leu). Both are normal amino acids — neither is a stop codon. So the substitution simply replaces one amino acid with another. The polypeptide chain will still have seven amino acids, because translation continues normally without interruption.
A substitution that changes one amino acid for another is called a missense mutation. It may or may not affect the protein's function, but it does not change the length of the polypeptide. …
Showing the 12 most recent of 25 on this concept.
- CBSE 2026Set 57/3/11 markMCQQ.The smallest part of DNA molecule that can be changed by point mutation is : (A) Oligonucleotide (B) Codon (C) Gene (D) Nucleotide
›Reveal solutionSolution
A point mutation changes a single nucleotide in the DNA molecule, so the smallest unit that can be altered is the nucleotide itself.
To understand why the answer is the nucleotide, we need to step back and think about what a point mutation actually is. The word "point" is the clue — it means a single, specific spot. In the language of DNA, that spot is one nucleotide. A nucleotide is the basic building block of DNA, consisting of a sugar, a phosphate, and a nitrogenous base (adenine, guanine, cytosine, or thymine). When a point mutation occurs, it swaps out just one of these bases for another — for example, replacing adenine with guanine at a particular position along the DNA strand.
Now, let's look at the other options to see why they don't fit. An oligonucleotide is a short chain of several nucleotides linked together — it's a small fragment, but still a sequence, not a single unit. A codon is a triplet of three consecutive nucleotides that codes for a specific amino acid during protein synthesis. Changing a codon usually means altering one of its three nucleotides, but the codon itself is a group, not the smallest possible change. A gene is a much larger segment of DNA, containing many codons and regulatory regions — far too big to be the smallest unit of change.
NoteThe NCERT textbook for Class 12 Biology (Chapter 6, "Molecular Basis of Inheritance") explicitly states that point mutations arise from the substitution of a single nucleotide base pair. This confirms that the nucleotide is the fundamental unit altered. …
- CBSE 2026Set EG1 markMCQQ.Sickle cell Anaemia disease is an example of which type of mutation?(a) Point mutation(b) Euploidy(c) Deletion(d) Translocation
›Reveal solutionSolution
Sickle-cell anaemia is caused by a single-base change in the β-globin gene — a point mutation, option (a).
Sickle-cell anaemia results from the substitution of a single nucleotide in the gene for the β-chain of haemoglobin: the codon GAG → GTG, which replaces glutamic acid by valine at the 6th position of the β-globin polypeptide (Glu → Val). Because it changes only one base pair, it is a classic point mutation (a substitution).
…
- CBSE 2026Set ZOOLOGY1 markMCQQ.Who coined the term 'mutation'?(a) Darwin(b) Lamarck(c) Hugo de Vries(d) Mendel
›Reveal solutionSolution
Hugo de Vries coined the term mutation, based on his work on Oenothera lamarckiana.
Hugo de Vries, a Dutch botanist, studied the evening primrose plant (Oenothera lamarckiana) and observed that new phenotypic variations arose suddenly, in a single generation, without any intermediate stages, and were heritable. He called these sudden, discontinuous, heritable changes 'mutations', distinguishing them from the small continuous variations that Darwin's theory of natural selection …
- CBSE 2026Set ANNUAL1 markQ.Fill in the blank: Sickle cell anemia is a classical example of ______ mutation.
›Reveal solutionSolution
Sickle-cell anaemia is caused by a point mutation in the beta-globin gene.
Sickle-cell anaemia is an autosomal recessive disorder resulting from a single base substitution in the gene coding for the beta chain of haemoglobin. The codon GAG changes to GTG, so glutamic acid at the sixth position is replaced by valine (Glu to Val). Because only one nucleotide (one base pair) is altered, this is called a point mutation. The mutant haemoglobin (HbS) …
- CBSE 2026Set ANNUAL1 markMCQQ.β - Thalassemia is controlled by a single gene HBB on –(a) Chromosome 16(b) Chromosome 13(c) Chromosome 11(d) Chromosome 14
›Reveal solutionSolution
β-thalassaemia is controlled by the HBB (beta-globin) gene, which lies on chromosome 11.
Thalassaemia is an autosomal recessive blood disorder in which the synthesis of one of the globin chains of haemoglobin is reduced. It is classified by which chain is affected:
- α-thalassaemia — defect in the α-globin genes (HBA1/HBA2), located on chromosome 16. …
- CBSE 2026Set ANNUAL1 markQ.Analyse how trisomy of chromosome 21 occurs in Down's Syndrome.
›Reveal solutionSolution
Trisomy 21 (Down's syndrome) is caused by non-disjunction of chromosome 21 during gamete formation, giving an extra copy of chromosome 21 in the zygote.
Normally each parent contributes one copy of chromosome 21, so the child has two. In Down's syndrome, during meiosis (gamete formation) the pair of chromosome 21 fails to separate properly — this is called non-disjunction. As a result, one gamete receives two copies of chromosome 21 instead of one.
…
- CBSE 2025Set 57/5/11 markMCQQ.What would happen if a gene encoding a polypeptide of 50 amino acids, 25th Codon (UAU) is mutated to "UAA" ? (A) A polypeptide of 49 amino acids will be formed. (B) A polypeptide of 25 amino acids will be formed. (C) A polypeptide of 24 amino acids will be formed. (D) A polypeptide of 50 amino acids will be formed.
›Reveal solutionSolution
Mutating codon 25 from UAU (tyrosine) to UAA (stop) introduces a premature termination signal; translation halts after incorporating the 24th amino acid, producing a truncated polypeptide of 24 amino acids.
The heart of this question lies in understanding how the genetic code directs protein synthesis and what happens when a nonsense mutation appears mid-sequence.
The Genetic Code and Stop Signals
Every three-nucleotide codon in mRNA either specifies an amino acid or signals termination. UAU codes for tyrosine, a standard amino acid. UAA, however, is one of three stop codons (UAA, UAG, UGA) that tell the ribosome "translation ends here." When the ribosome encounters a stop codon, it releases the polypeptide chain and dissociates from the mRNA—no amino acid is added at that position.
In the original gene, codon 25 reads UAU, so tyrosine is incorporated at position 25, and translation continues through all 50 codons to produce a 50-amino-acid polypeptide. The mutation changes codon 25 to UAA, converting it into a premature stop signal.
Step-by-Step Analysis
-
Translation begins normally
The ribosome starts at the start codon (AUG, position 1) and moves codon by codon, adding amino acids to the growing chain. Codons 1 through 24 are unaffected by the mutation, so amino acids 1–24 are incorporated exactly as before.
-
The ribosome reaches codon 25
Instead of reading UAU and adding tyrosine, the ribosome now reads UAA. Because UAA is a stop codon, no amino acid corresponds to it. The ribosome recognizes the termination signal.
-
Translation terminates prematurely
Release factors bind to the stop codon, the polypeptide is cleaved from the tRNA, and the ribosome dissociates. The chain that has been synthesized up to this point contains only the amino acids encoded by codons 1 through 24.
-
Counting the final length
Since translation stops at codon 25 (which now codes for nothing), the polypeptide consists of the 24 amino acids that were added before the stop signal. Codons 26–50 are never translated. …
-
- CBSE 2025Set 57/6/11 markMCQQ.SNPs in Human Genome Project refers to : (A) Polymorphism in repetitive sequences. (B) Single-base DNA differences. (C) Single changes in nucleotide of mRNA. (D) Loss or gain of a gene function.
›Reveal solutionSolution
SNPs (Single Nucleotide Polymorphisms) are single-base DNA differences in the genome where one nucleotide varies between individuals at the same position.
The Human Genome Project, completed in 2003, was a landmark international effort to map and sequence the entire human genome—all three billion base pairs of DNA that make up our genetic blueprint. One of the most significant discoveries from this project was the identification and cataloguing of SNPs, which stands for Single Nucleotide Polymorphisms.
To understand what SNPs are, picture the human genome as an enormous instruction manual written in a four-letter alphabet: A (adenine), T (thymine), G (guanine), and C (cytosine). Now imagine comparing your manual with someone else's. Most of the text would be identical—humans share about 99.9% of their DNA sequence. But in that remaining 0.1%, you'd find millions of spots where a single letter differs. At one particular position, you might have an 'A' while another person has a 'G'. That single-letter difference is a SNP.
These variations occur roughly once every 1000 bases throughout the genome, making them the most common type of genetic variation among people. SNPs are inherited from parents and passed to offspring, which is why they serve as valuable markers for tracking disease genes and understanding human evolution and migration patterns.
NoteThe term "polymorphism" simply means "many forms"—in genetics, it refers to variations that exist in a population. SNPs are polymorphisms at the single-nucleotide level. …
- CBSE 2025Set ANNUAL1 markMCQQ.The cause of sickle cell anemia is :(a) Point mutation(b) Natural selection(c) Adaptive radiation(d) Both (B) and (C)
›Reveal solutionSolution
A single base substitution changes one amino acid in the beta-globin chain, causing sickle cell anemia.
Sickle cell anemia is a classic Mendelian (monogenic) recessive disorder caused by the substitution of a single nucleotide (GAG → GTG) in the sixth codon of the beta-globin gene on chromosome 11. This point mutation changes the amino acid at position 6 of the beta-globin chain from glutamic acid to valine. The altered haemoglobin (HbS) polymerises under lo …
- CBSE 2025Set ANNUAL1 markQ.What is point mutation?
›Reveal solutionSolution
A point mutation is the smallest-scale genetic mutation, altering just a single base pair, yet it can still have significant phenotypic consequences.
A point mutation is a mutation that involves a change at just a single point (nucleotide/base pair) in the DNA sequence — this may be a substitution of one base for another, or the insertion or deletion of a single base. A classic example is sickle-cell anaemia, which is caused by a single point mutation (a substitution) in the gene coding for the beta-globin chain of haemoglobin, changing the codon for glutamic acid to one for valine at the six …
- CBSE 2025Set ZOOLOGY1 markMCQQ.What is the diploid chromosome number in a person suffering from Down syndrome?(i) 45(ii) 46(iii) 47(iv) 48
›Reveal solutionSolution
Down syndrome is caused by an extra chromosome 21 (trisomy 21), so the diploid number rises from 46 to 47.
The normal human diploid chromosome number is 46 (2n = 46): 44 autosomes + 2 sex chromosomes. Down syndrome arises from trisomy of chromosome 21 — the affected individual carries three copies of chromosome 21 instead of two, usually …
- CBSE 2024Set ANNUAL1 markQ.Give an example of point mutation.
›Reveal solutionSolution
Sickle-cell anaemia is a classic example of a point mutation.
A point mutation involves a change in a single base pair of DNA. In sickle-cell anaemia, a single base substitution (GAG→GTG) in the sixth codon of the β-globin gene changes the amino acid glutamic acid to valine, producing abnormal haemoglobin (HbS) that causes red bl …
🎓Unlock everything free for 14 days
- ✓Full step-by-step solutions
- ✓Concept-first explanations
- ✓Methods, shortcuts & mistakes
- ✓PYQ mapping + timed mock tests
Full access for 14 days. No credit card required.