Q.If the coding sequence in a transcription unit is written as follows:
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the sequence of the mRNA.

Transcription copies the sequence of one DNA strand, the template (non-coding/antisense) strand, into a complementary RNA molecule, catalysed by RNA polymerases, while the other DNA strand, matching the RNA in sequence, is the coding (non-template/sense) strand. Eukaryotes use three RNA polymerases: RNA Pol I makes the large rRNAs (except 5S), RNA Pol II makes the mRNA precursor (hnRNA), and RNA Pol III makes tRNA, 5S rRNA and snRNAs; because each eukaryotic mRNA carries only one gene's coding information, eukaryotic mRNAs are monocistronic. Synthesis always runs 5' to 3', reading a 3'-to-5' template, starting at a promoter that carries regulatory elements (enhancers, which increase transcription, or silencers, which decrease it, bound by transcription factors that guide RNA polymerase since it cannot bind DNA on its own), a TATA/Hogness box about 25 bp upstream of the start site, and the transcription start site itself; a mediator complex relays signals between distant regulatory transcription factors and RNA Pol II; transcri …